Handle exception

As I mentioned in last blog, there is a problem unsolved in the program. That is , each genome must have unique primers. If not, the program is endless.
There exceptions have been considered:
1. the file is empty
2.the size of genome is too small to suggest a primer of length 20
3.one genome A is subset of another genome B, there is no way to find a unique primer for genome A.

The program was tested to handle successfully these three exceptions.
test the program on the  three strains of Bacillus anthracis:

Bacillus anthracis str.A0248.fa : ATAAGCGAATAAGAATGTAG

Bacillus anthracis str.CDC684.fa : TGAAGTTGCTGAGAAGAGAT

Bacillus anthracis str.Sterne.fa : CATCAGTTACAAAAAGAATG

real 168.97

user 167.91

sys 0.16

So far,the problems mentioned before have been solved. The next work is to write a scientific report for this project.